Thursday, November 28, 2019
Evolution Of The Power Of The Presidency Essays -
  Evolution Of The Power Of The Presidency    The views of the presidency by the first sixteen presidents varied widely but all of their actions set precedents for their successors to use, expand, or even curtail the power of the office. Some believed in the Whig theory of strict adherence to the constitution, while others believed the president was the steward of the people with a loose interpretation of it. The power of the office expanded through the years, however it only expanded as far as the public and congress allowed.  George Washington was the first President of the United States of America and realizing this he acted carefully and deliberately, aware of the need to build an executive structure that could accommodate future presidents. Washingtons position as the first president of the United States allowed him to set many precedents that are still followed by executives today. Washington believed his power came from article II of the U.S. Constitution. He was very protective of executive powers and did not involve the executive branch in legislative matters. He established the initial implied powers of the president by creating the national bank, excise tax, and assumption of state debts from the Revolutionary War. The creation of those bureaucracies set the precedent that allowed presidents after him to establish and empower new bureaucratic agencies to execute the duties of the executive office.  Thomas Jefferson was the third president of the United States and viewed the office of the president to be strictly constructed by the constitution. He, like Washington, believed his power as president derived directly from the constitution and the affection of the people. Although he had a Whig theory he made the Louisiana Purchase in 1803, which the president had no authority according to the constitution to do; the congress has control of the purse strings according to the constitution. President Jefferson was the first to pass out the rewards of the spoils system. In his second term he became the first President to use economic sanctions against a foreign power, with the embargo act of 1807, in order to achieve a goal. With the exception of the Louisiana Purchase, Jeffersons administration was a negative presidency in that it rolled back federal policies. His economic policies enabled future presidents to use the foreign treaty powers as a weapon in diplomatic negotiations with o   ther countries without interference from congress.  In the election that ended the Era of good feelings(1824) John Q. Adams won the presidency. While he was not a very powerful president himself, he is responsible for the beginning of the legislative role of the presidency. He believed the role of the president was to be a steward of the people and favored a loose interpretation of the constitution. He advocated internal improvements such as better roads, canals, schools, and a better army and navy. The action of Adams in an attempt to get the federal government to finance those projects is the basis that is used to legitimize federal funding even today.   Andrew Jackson is arguably one of the most influential presidents in history. He believed that government had a social obligation to the people and that it was the most democratic branch. He was the first president to create a grassroots political party and used its strong public support to tie the Electoral College to the popular vote among other things. He used the power of the presidency in a manner that no previous president had by influencing legislation with threat of a veto.   James K. Polk is the first dark horse candidate to win the presidency and in spite of this fact he was still able to significantly expand the power of the office. He believed in being a steward of the people and maintaining strong executive power. By paying close attention to the budget and setting a budgetary agenda he was able to increase the power of the presidency and started an era of administrative presidents that still exists today.   Abraham Lincoln was the last president in the 19th century to further expand the power of the presidency. Because he was a member of the minority party with a divided cabinet and only received 40% of the popular vote had to rely    
Sunday, November 24, 2019
Phenylalanine hydroxylase (PAH) Gene Essay Example
Phenylalanine hydroxylase (PAH) Gene Essay Example   Phenylalanine hydroxylase (PAH) Gene Paper  Phenylalanine hydroxylase (PAH) Gene Paper          Phenylalanine hydroxylase (PAH) Gene    Background:          Phenylalanine hydroxylase (PAH) encodes the liver-secreted enzyme of the same name, a catalyst for the hydroxylation of tyrosine from phenylalanine, a rate-limiting step in the catabolism of the latter. This reaction only occurs in the presence of the cofactor tetrahydrobiopterin (BH4) as well as molecular oxygen and iron (1).  Mutations in the PAH gene are generally caused by a change of an amino acid, for example, the change of arginine to tryptophan (2, 3). The numerous possible mutations in this gene result in a lack of enzyme activity. Thus, because of its main function, the deficiency in the activity of PAH causes a marked intolerance of the consumption of phenylalanine, an essential amino acid. This causes phenylketonuria (PKU), non-phenylketonuria hyperphenylalaninemia (non-PKU HPA), mild hyperphenylalaninemia (MHP), and other variant PKU (4, 5, 6).  Defects in the PAH gene leads to the deficiency or the disruption of the production of the PAH enzyme; this is most commonly related to the resulting disorder, phenylketonuria. PKU is an autosomal, inborn, recessive disorder of phenylalanine metabolism (7). There are three common types of PKU. First, there is classical PKU, caused by the mutation of both alleles of the PAH gene in chromosome 12 which results in a severe deficiency or complete absence of the PAH enzyme, leading to toxic levels of unhydroxylated phenylalanine, typically over 10 times higher than normal concentrations (i.e. over 1000 à µmol compared to the normal 100 à µmol). Next, there is MHP, the mildest form of the PAH enzyme deficiency, with phenylalanine levels below 600 à µmol but above normal. Thirdly, there is non-PKU HPA, caused by mutations in the PAH locus that hinder BH4 synthesis and regeneration. This relatively milder form of the disorder often results in heterozygous cases through a combination of mi   ld and severe mutations (4, 7, 8).  Severe classical PKU, if left untreated, is commonly known to result in the impedance of postnatal cognitive development causing mental retardation and in metabolic abnormalities causing increased phenylalanine in in the blood circulation and phenylpyruvic acid in the urine. PKU has also been known to cause skin abnormalities, organ damage, different kinds of posture peculiarities, pregnancy problems (maternal PKU), an odor describe as ââ¬Å"mousyâ⬠, as well as other mental issues such as epilepsy, hyperactivity, and psychotic episodes (1,4,7,8). The most common negative effect associated with PKU, mental retardation, is caused by a neurotoxic effect of HPA. And while PKU is an inherited disorder, its negative effects could also be induced in the offspring of mothers with PKU, resulting not only in high fetus mortality rates but also in a high probability that the children are born with growth and mental retardations as well as malformations. This is known as PKU embryofetopath   y or maternal PKU syndrome (8). Conversely, children born with non-PKU HPA and MHP have marked lower risks of being affect with the adverse effects of the disorder and can have normal development mentally and physically even with the absence of treatment (4,8).  Despite the severe potential effects of classical PKU, newborn screening for high levels of phenylalanine has helped early diagnosis of the disorder, which is then followed by rapid treatment. Dietary restrictions of phenylalanine has been used for early treatment of PKU which, while not necessarily lead to complete normalization of IQ, was shown to be predictive of overall IQ with the complete lack of treatment in classical PKU patients leading to severe and irreversible cognitive retardation.(1,8) Thus, primary screening of neonates and children as well as awareness of the disorder for the parents are essential (3, 6).  Results and Discussion:  PAH chromosomal map position and nearby genes:  The location of the PAH gene is at chromosome 12. Its long arm (q) is comprised of 13 exons with an approximate length of 90 kb.    Figure 1 Chromosome 12 (9)  Figure 1, above, is a representation of the entire chromosome 12 with both its short arm (p) and long arm (q) as it appears in the Ensembl website, albeit cropped to fit the page. This figure can be found by searching for the PAH gene and clicking on the ââ¬Å"Locationâ⬠ link on the PAH listing. The website lists the location of the gene to be at ââ¬Å"Chromosome 12: 103,232,104-103,311,381 reverse strand.â⬠(2) Though the website does not explicitly state where in chromosome 12 PAH is located, one can infer additional details from the provided images. For example, confusion can ensue from the fact that the indicated location in the image in the Ensembl website is on the long arm on q23.2, while previous sources have stated that it is located on q22-24.2. However, from the code in the location and the additional images, one can infer that these are the transcribed portions of the gene, two of which are illustrated in the site. Furthermore, one can see that the PAH gene is    flanked by the genes insulin-like growth factor 1 (IGF1), or somatomedin C, and achaete-scute complex homolog 1 (ASCL1). To obtain the information, though, one needs to explore the interactive image (see Figure 2 below) and go to the individual pages of the neighbor genes.  Figure 2 Detailed view of region near PAH (9)  The NCBI website, however, while very extensive in details, and containing multiple transcripts pertaining to the PAH gene, can be somewhat confusing with regard to the Map Viewer. Going through the home page and directly searching for the desired gene results in a very large and confusing map, with the details of the gene and its neighboring gene beyond the page to right. For a beginner who is not quite sure what to look for, the NCBI Map Viewer can be very overwhelming. Focusing on the table and not the map, however, one can see that the PAH gene is located in Chromosome 12, in the long arm q22-q24.2; this information is under the heading ââ¬Å"Cytoâ⬠ (for cytogenic) and stated as ââ¬Å"12q22-q24.2â⬠ (10). Again, this might not be immediately clear to a beginner. Furthermore, the different master map options (Morbid, Gene_cyto, etc.) individually show different arrangements of the symbols, not all of which seem to be genes. Thus, it is very hard to decipher which genes    are actually near PAH, although zooming in on the ââ¬Å"Genes on Sequenceâ⬠ and ââ¬Å"Phenotypeâ⬠ maps do reveal the proximity of IGF1 and ASCL1. In all, for a beginner, the Ensembl website proved to be much easier to use to answer the first question.  The intron/exon structure of the PAH gene:    It was very difficult to find an illustration of the structure of the PAH gene in the NCBI website. However, the information page for the gene stated that the gene spans 90 kb with the entire sequence and its adjacent regions a total of 171 kb. Furthermore, it states that the gene contains 13 exons, which consequently means that it has 12 introns (number of introns is one less than the number of exons) (1). After some searching, however, beginning with clicking the available links for PAH in the Map Viewer table, the link ââ¬Å"svâ⬠ led to a page with the title ââ¬Å"Homo sapiens chromosome 12 genomic contig, GRCh37 reference primary assembly.â⬠ Searching for the gene gives the following (zoomed-in and cropped) structure:  à  Figure 3 Structure of PAH gene (11)  Though not obvious from the first glance, later we will see that the bottom sequence actually represents the structure of the PAH, with the vertical green lines representing the 13 exons. After further searching, the following (rotated) PAH structure showing the 13 exons and 12 introns can be found in the Map Viewer under ââ¬Å"ensRNAâ⬠:  à  Figure 4 Another illustration of the structure of PAH gene (11)  Finding those, however, takes previous explicit knowledge and some work to track down the specific illustrations. In contrast, finding the number of exons and introns and an illustration of the structure of the PAH gene in the Ensembl website was very straightforward. The following illustration can be found in the same page as Figure 1:  Figure 5 Ensembl illustration of PAH gene structure  This strand, one of the transcripts available in the Ensembl page, clearly shows the 13 exons in a DNA sequence. Comparing this structure to Figures 3 and 4, the numbers and the arrangements of the exons and introns are exactly the same. However, relative to all the tedious searching needed to find the same answers in the NCBI website, the information needed for the question was instantly available from the Ensembl site, and the interface was very easy to understand.    Common PAH mutations:  Mutations in general can refer to abnormalities in function or structure of the concerned enzyme in the gene phenotype. As previously discussed, however, such as the causes of PKU and HPA, the human PAH gene has displayed allelic differences and pathogenic transformations throughout its structure. The common types of mutations and their occurrence according to a previous study are: missense mutations with 62% of the alleles, small or large deletions with 13%, splicing defects with 11%, silent polymorphisms with 6%, nonsense mutations with 5%, and insertions with 2% of the PAH alleles. (6)    Table1 PAH mutation statistics  Mutation Type:  # of Mutation(s)  Missense  336  Deletion  73  Splice  62  Silent  32  Nonsense  28  Insertion  10  Sil./Splice  3  Unknown  3  Total mutations: 547  Most reported Mutation  (Association): p.R408W (214)      Missense, as can be seen above, is the most common cause of mutation in the PAH gene, the molecular mechanism of this is the improper folding of the protein structure, causing aggregation or degradation. As mentioned earlier, the mutations of PAH are commonly caused by single changes in the amino acid. One of the missense mutations, for example, occurs in E1 nucleotide 1 with the change of ATG to GTG. However, there is also missense mutation in region E3 with sequence 187.000 in nucleotide 187; this is called ACC/CCC;CAC/AAC. The second most common type of mutation is deletion. An example of deletion mutation is in regions E2-12 with sequence 168.001 in nucleotide 168. This is called GAG/GAA;G/A and has been noted to have occurred in Palestinians Arabs. (2, 3, 12) à  Other examples can be seen in Appendix (I).  As mentioned earlier, there are three common variations of PKU: classical PKU, MHP, and non-PKU HPA. These variations which are basically different degrees of severity of the disorder are caused by the different kinds of mutations that cause varying PAH activity as well as allelic variations. The latter effect at the locus of the gene determines the metabolic phenotype of the enzyme deficiency. In general, however, the mutations in the PAH gene are localized in a main part of the gene instead of being randomly distributed, as they occur either within or without the active site. What is interesting to note is that the PAH gene in intron 12 involves the single base change of guanine to adenine in the canonical 5-prime splice donor site where the first identified PKU mutation occurred. (3)  Two out of the 6 links given by the Gene Gateway page were no longer working, one was solely dedicated to SNP, one was a link to a database that had links to other databases, and the last two were already explored thoroughly in previous parts of this assignment. The data presented in this section were mostly from the entire site dedicated to PAH gene mutations, the Phenylalanine Hydoxylase Locus Knowledgebase (5). This site, also a database, was arrived at after searching through the Locus Specific Mutation Databases which in turn arrived at from Human Genome Variation Society: Variation Databases and Related Sites. While the OMIM site did give some details about previous studies related to PAH gene mutations, they were more of a history of the mutations and examples of the studies. Finding the needed information was difficult because one needed to go through link after link and website after website, sometimes even arriving at the same website numerous times through different pathwa   ys and still not obtaining any results. The PAHdb was by far, the only site that showed any data regarding the common mutations.    Single nucleotide polymorphisms (SNPs) of the PAH gene:    To date, 1220 SNPs for the PAH gene have been discovered, although GeneCards (2) states only 1097 from the NCBI website. In general, the SNPs involve the changing of a single base, as shown in Appendices I and II. Examples are the three found on exon 3, each of which has a single change of base, name cytocine, thiamine, and adeninine(13).  Examples of these PAH gene SNPs are the rs63749677, rs63749676, rs63581460 and rs63499960; some of these are tabulated in Appendix (II). These SNPs are not randomly distributed as out of the 13 exons, they are seen in exons 1-7 and 12. Searching the NCBI website, however, resulted in 55 entries of SNPs with the following format:    rs79931499 [Homo sapiens]  CAATCCTTTGGGTGTATGGGTCGTAG[C/G]GAACTGAGAAGGGCCGAGGTATTGT  12    The above entry, an example of the results from the query in the NCBI SNP website, shows essential information about the SNP as well as options one can view. Compared to the other related links, which did not yield any useful information other than linking back to this site, the NCBI site dedicated purely to SNPs was simple and the information was easy to retrieve. Due to the very large number of SNPs, however, it would be difficult to evaluate all of them.  Designing PCR primers:    The given instructions and the program given in the website were rather straightforward, so the designing of the primer was the easiest part of the activity. The mRNA sequence was easily downloadable and the program was user-friendly (14). Being able to design primers this way was very fast and easy. The resulting primers are in Appendix (III).    References:    1. [26/08/10]; Available from: ncbi.nlm.nih.gov/omim/612349  2. Hoeks M, den Heijer M, Janssen M. Adult issues in phenylketonuria. The Netherlands journal of medicine2009;67(1):2.  3. [21/09/09]; Available from: ensembl.org/index.html.  4. [26/08/10]; Available from: genecards.org/cgi-bin/carddisp.pl?gene=PAHsearch=pah#loc  5. [26/08/10]; Available from: pahdb.mcgill.ca.  6. Carter K, Byck S, Waters P, Richards B, Nowacki P, Laframboise R, et al. Mutation at the phenylalanine hydroxylase gene (PAH) and its use to document population genetic variation: the Quebec experience. European Journal of Human Genetics1998;6(1):61-70.  7.à   [26/08/10]; Available from: ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gndpart=phenylketonuria  8. [26/08/10]; Available from: ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=genepart=pku  9. [26/08/10]; Available from: ensembl.org/Homo_sapiens/Location/View?db=core;g=ENSG00000171759;r=12:103232104-103311381;t=ENST00000307000  10. [26/08/10]; Available from: ncbi.nlm.nih.gov/projects/mapview/maps.cgi?taxid=9606chr=12MAPS=pheno,morbid,genec,decode,ensrna,ensgenes,rnaRn,rnaMm,rnaHs,rnaGga,rnaBt,gbdna,rna,ugHs,genes-rcmd=focusfill=80query=uid(136508683,136446655,12845117,12579049,8990832,717234,698472,11088097,11049717,6481463,570698,568170,34586070,16320694,13572526,34590012,128619463,415205)QSTR=pah  11. [26/08/10]; Available from: ncbi.nlm.nih.gov/projects/sviewer/?id=NT_029419.12v=65375409..65454686  12. *Robin A Williams, 2 Cyril DS Mamotte,2 *John R Burnett1,3. Phenylketonuria: An Inborn Error of Phenylalanine Metabolism  13.à  Ã  Ã  Ã  Ã  Ã   à   [updated 21/09/09]; Available from: ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=5053  14.à  Ã  Ã  Ã  Ã  Ã   à   [21/09/09]; Available from: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi  Appendices:      Appendix (I) Examples    1.  Systematic Name:  c.1AG  Region:  E1  Reference (1st):  Mutation Name:  p.M1V  Sequence:  0.000  JOHN SW, ROZEN R, LAFRAMBOISE R, LABERGE C, SCRIVER CR: Novel PKU mutation on haplotype 2 in French-Canadians. Am J Hum Genet 45:905-909, 1989  Other Name:  ATG/GTG  Length:  1  Nucleotide No.:  1  Rest. Site:  -Xba I  Mutation Type:  Missense  Syst. Name gDNA:  Date Entered:  1997-01-31  CpG/Fs/Pm:  No/No/No  2.  Systematic Name:  c.3GA  Region:  E1  EIKEN HG, KNAPPSKOG PM, APOLD J, SKJELKVÃâ¦LE L, BOMAN H: A de novo phenylketonuria mutation: ATG (Met) to ATA (Ile) in the start codon of the phenylalanine hydroxylase gene. Hum Mut 1:388-391, 1992  Mutation Name:  p.M1I  Sequence:  3.000  Other Name:  ATG/ATA  Length:  1  Nucleotide No.:  3  Rest. Site:  -NspI  Mutation Type:  Missense  Syst. Name gDNA:  Date Entered:  1997-01-31  CpG/Fs/Pm:  No/No/No  3.  Systematic Name:  c.117CG  Region:  E2  FORREST SM, DAHL HH, HOWELLS DW, DIANZANI I, COTTON RGH: Mutation detection in phenylketonuria by using chemical cleavage of mismatch: Importance of using probes from both normal and patient samples. Am J Hum Genet 49:175-183, 1991  Mutation Name:  p.F39L  Sequence:  117.000  Other Name:  TTC/TTG  Length:  1  Nucleotide No.:  117  Rest. Site:  -MboII, +MaeIII  Mutation Type:  Missense  Syst. Name gDNA:  Erlandsen H, Pey AL, Gmez A, Pà ©rez B, Desviat LR, Aguado C, Koch R, Surendran S, Tyring S, Matalon R, Scriver CR, Ugarte M, Martà nez A, Stevens RC.: Correction of kinetic and stability defects by tetrahydrobiopterin in phenylketonuria patients with certain phenylalanine hydroxylase mutations.  Date Entered:  1997-01-31  CpG/Fs/Pm:  No/No/No      Appendix (II) SNPs of the PAH gene  Region  Contig  position  mRNA  pos  dbSNP rs#  cluster id  Hetero-  zygosity  Function  dbSNP  allele  Protein  residue  Codon  pos  Amino acid  pos  exon_12  26716405  1750  rs59326968  N.D.  synonymous  C  Asn [N]  3  426  contig reference  T  Asn [N]  3  426  exon_7  26728783  1314  rs5030851  N.D.  missense  T  Leu [L]  2  281  contig reference  C  Pro [P]  2  281  exon_6  26731200  1061  rs5030653  N.D.  missense  (22bp)  [CIKPMLAN]  1  197  frame shift  -/TGTATAAAACCCATGCTTGCTA  1  197  contig reference  (22bp)  [LYKTHACY]  1  197  26731262  1020  rs17852373  N.D.  missense  G  Gly [G]  2  183  contig reference  A  Glu [E]  2  183  exon_3  26770856  671  rs5030842  N.D.  missense  C  Pro [P]  1  67  contig reference  T  Ser [S]  1  67  contig reference  A  Ser [S]  3  36  exon_1  26793098  474  start codon  1        Appendix (III) Designed Primers    Exon1 ENSE00001141448  CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT  TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC  TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG  CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG  CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA  CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA  CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC  TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA  CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG    PCR primer design:    No mispriming library specified  Using 1-based sequence positions  OLIGOà  Ã  Ã  Ã  Ã  Ã  Ã  Ã  Ã  Ã  Ã   à  Ã  Ã  Ã  Ã  Ã  Ã  Ã  Ã  Ã  Ã  start à  Ã  len à  Ã  Ã  tm à  Ã  Ã  Ã  Ã  Ã  gc% à  Ã  anyà   à  Ã  3à  Ã  Ã  Ã  Ã   à  seq  LEFT PRIMERà  Ã  Ã  Ã  Ã  Ã  Ã   à  Ã  369à  Ã   20à  Ã   59.83à  Ã   55.00à   6.00à   2.00 à  Ã  TCCTCCCTAGTGCGAGGTTA  RIGHT PRIMERà  Ã  Ã  Ã  Ã   à  522à  Ã   20à  Ã   59.98à  Ã   55.00à   3.00à   2.00 à  Ã  CAGAGAGTTTCCTGCCCAAG  SEQUENCE SIZE: 533  INCLUDED REGION SIZE: 533  PRODUCT SIZE: 154, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 3.00  1 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT  61 TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC  121 TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG  181 CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG  241 CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA  301 CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA  361 CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC    421 TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA  481 CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG    KEYS (in order of precedence):   left primer   right primer  ADDITIONAL OLIGOS  start à  Ã  len à  Ã  Ã  tm à  Ã  Ã  Ã  Ã  Ã  gc% à  Ã  anyà   à  Ã  Ã  Ã  3à  Ã  Ã  Ã  Ã  Ã  Ã  Ã  Ã  Ã   à  seq  1 LEFT PRIMERà  Ã  Ã  Ã  Ã   à  Ã  Ã  339à  Ã   20à  Ã   59.77à  Ã   50.00 à  Ã  3.00 à  Ã  1.00à  Ã  Ã   à  ACGCAAGAGACACCCTTTGT  RIGHT PRIMERà  Ã  Ã  Ã  Ã  Ã   522à  Ã   20à  Ã   59.98à  Ã   55.00 à  Ã  3.00 à  Ã  2.00 à  Ã  Ã  Ã  Ã  CAGAGAGTTTCCTGCCCAAG  PRODUCT SIZE: 184, PAIR ANY COMPL: 6.00, PAIR 3 COMPL: 2.00  2 LEFT PRIMERà  Ã  Ã  Ã  Ã  Ã  Ã   318à  Ã   20à  Ã   59.32à  Ã   55.00à   4.00à   2.00 GTTACTGTGCGGAGATGCAC  RIGHT PRIMERà  Ã  Ã  Ã  Ã  Ã   522à  Ã   20à  Ã   59.98à  Ã   55.00à   3.00à   2.00 CAGAGAGTTTCCTGCCCAAG  PRODUCT SIZE: 205, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00  3 LEFT PRIMERà  Ã  Ã  Ã  Ã  Ã  Ã   157à  Ã   20à  Ã   60.07à  Ã   55.00à   2.00à   0.00 CTGGCTTCTTCCCTTTACCC  RIGHT PRIMERà  Ã  Ã  Ã  Ã  Ã   337à  Ã   20à  Ã   59.32à  Ã   55.00à   4.00à   3.00 GTGCATCTCCGCACAGTAAC  PRODUCT SIZE: 181, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00  4 LEFT PRIMERà  Ã  Ã  Ã  Ã  Ã  Ã   156à  Ã   20à  Ã   60.07à  Ã   55.00à   3.00à   0.00 CCTGGCTTCTTCCCTTTACC  RIGHT PRIMERà  Ã  Ã  Ã  Ã  Ã   337à  Ã   20à  Ã   59.32à  Ã   55.00à   4.00à   3.00 GTGCATCTCCGCACAGTAAC  PRODUCT SIZE: 182, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00  Statistics  conà  Ã   tooà  Ã  Ã   inà  Ã  Ã   inà  Ã  Ã  Ã  Ã  Ã  Ã  Ã  Ã   noà  Ã  Ã   tmà  Ã  Ã   tmà   highà   highà  Ã  Ã  Ã  Ã  Ã  Ã   high  sidà   manyà  Ã   tarà   exclà  Ã   badà  Ã  Ã   GCà  Ã   tooà  Ã   tooà  Ã   anyà  Ã  Ã   3à   polyà  Ã   end  eredà  Ã  Ã   Nsà  Ã   getà  Ã   regà  Ã   GC% clampà  Ã   lowà   high compl complà  Ã  Ã  Ã   Xà   stabà  Ã  Ã   ok  Leftà  Ã  Ã   3637à  Ã  Ã  Ã   0à  Ã  Ã  Ã   0à  Ã  Ã  Ã   0à  Ã   162à  Ã  Ã  Ã   0à  Ã   419à   2558à  Ã  Ã  Ã   0à  Ã  Ã  Ã   2à  Ã  Ã   22à  Ã  Ã   73à  Ã   401  Rightà  Ã   3701à  Ã  Ã  Ã   0à  Ã  Ã  Ã   0à  Ã  Ã  Ã   0à  Ã   130à  Ã  Ã  Ã   0à  Ã   321à   2817à  Ã  Ã  Ã   0à  Ã  Ã  Ã   2à  Ã  Ã  Ã   0à  Ã  Ã   78à  Ã   353  Pair Stats:  considered 140, unacceptable product size 129, high end compl 3, ok 8  primer3 release 1.1.4  KEYS (in order of precedence):   left primer   right primer  ADDITIONAL OLIGOS  start à  Ã  len à  Ã  Ã  tm à  Ã  Ã  Ã  Ã  Ã  gc% à  Ã  anyà   à  Ã  3à  Ã  Ã  Ã  Ã  Ã  Ã   à  seq  1 LEFT PRIMERà  Ã  Ã  Ã  Ã  Ã  Ã  Ã   19à  Ã   20à  Ã   60.21à  Ã   50.00à   5.00à   2.00 à  Ã  Ã  Ã  GCAGTGCCCTCCAGAAAATA  RIGHT PRIMERà  Ã  Ã  Ã  Ã  Ã   265à  Ã   20à  Ã   58.12à  Ã   40.00à   3.00à   0.00 à  Ã  TCAAAGATGACCCCAAAAGA  PRODUCT SIZE: 247, PAIR ANY COMPL: 2.00, PAIR 3 COMPL: 0.00  2 LEFT PRIMERà  Ã  Ã  Ã  Ã  Ã  Ã  Ã   19à  Ã   20à  Ã   60.21à  Ã   50.00à   5.00à   2.00à  Ã   à  GCAGTGCCCTCCAGAAAATA  RIGHT PRIMERà  Ã  Ã  Ã  Ã  Ã   260à  Ã   22à  Ã   60.05à  Ã   40.91à   4.00à   0.00 à  Ã  GATGACCCCAAAAGATTTACCA  PRODUCT SIZE: 242, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00  3 LEFT PRIMERà  Ã  Ã  Ã  Ã  Ã  Ã  Ã   45à  Ã   20à  Ã   60.39à  Ã   50.00à   6.00à   1.00à  Ã   à  AGCCATGGACAGAATGTGGT  RIGHT PRIMERà  Ã  Ã  Ã  Ã  Ã   265à  Ã   20à  Ã   58.12à  Ã   40.00à   3.00à   0.00 à  Ã  TCAAAGATGACCCCAAAAGA  PRODUCT SIZE: 221, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00  4 LEFT PRIMERà  Ã  Ã  Ã  Ã  Ã  Ã  Ã   19à  Ã   20à  Ã   60.21à  Ã   50.00à   5.00à   2.00 à  Ã  Ã  Ã  GCAGTGCCCTCCAGAAAATA  RIGHT PRIMERà  Ã  Ã  Ã  Ã  Ã   258à  Ã   20à  Ã   57.92à  Ã   40.00à   4.00à   0.00 à  Ã  TGACCCCAAAAGATTTACCA  PRODUCT SIZE: 240, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00  Statistics  conà  Ã   tooà  Ã  Ã   inà  Ã  Ã   inà  Ã  Ã  Ã  Ã  Ã  Ã  Ã  Ã   noà  Ã  Ã   tmà  Ã  Ã   tmà   highà   highà  Ã  Ã  Ã  Ã  Ã  Ã   high  sidà   manyà  Ã   tarà   exclà  Ã   badà  Ã  Ã   GCà  Ã   tooà  Ã   tooà  Ã   anyà  Ã  Ã   3à   polyà  Ã   end  eredà  Ã  Ã   Nsà  Ã   getà  Ã   regà  Ã   GC% clampà  Ã   lowà   high compl complà  Ã  Ã  Ã   Xà   stabà  Ã  Ã   ok  Leftà   à  Ã  7708à  Ã  Ã  Ã   0à  Ã  Ã  Ã   0à  Ã  Ã  Ã   0à  Ã   791à  Ã  Ã  Ã   0à   4562à  Ã   600à  Ã  Ã  Ã   0à  Ã  Ã   14à  Ã  Ã  Ã   0à  Ã  Ã   52à   1689  Rightà  Ã   7734à  Ã  Ã  Ã   0à  Ã  Ã  Ã   0à  Ã  Ã  Ã   0à   1269à  Ã  Ã  Ã   0à   4609à  Ã   311à  Ã  Ã  Ã   0à  Ã  Ã  Ã   6à  Ã  Ã  Ã   0à  Ã  Ã   44à   1495  Pair Stats:  considered 2222, unacceptable product size 2195, high end compl 6, ok 21  primer3 release 1.1.4    
Thursday, November 21, 2019
Management Information System Essay Example | Topics and Well Written Essays - 1250 words
Management Information System - Essay Example    The Watchiloo has been designed as an embedded player for social network sites to allow for users to access advanced features. The first part of the article shall analyze how these devices can be used to communicate with their advanced features. The article shall also cover different aspects that are involved with the use of these devices such as the number of users for each and their price range. The second part of the article shall cover strengths and weaknesses of this article. Finally, the article shall then cover writers' opinion on the articles and recommendation on what can be done to improve them. Introduction High definition television has brought about some change in the mode of social networking. Thus, with the invention of high definition television (HDTV), there has been remarkable change in video and audio conferencing. Several versions of high definition televisions currently exist in the market including internet enabled ones with built in wireless internet connectivi   ty and others with port for wireless or wired connectivity. Since invention of live chat tools by Google and Microsoft, Google+ hangout on air and Skype respectively, there has been increased need to include more users in chat sessions than the logical one user when used in personal computers or smart phones2. Main Themes The main idea of these articles is to analyze and ascertain the extent in which integration between HDTV and chat- enabled devices that have been manufactured. In this article, I shall focus on two essential devices that have been manufactured for this purpose. It shall also cover some issues relating to these devices such as Working capability of these devices The number of users which they support Their price range and connectivity and Their multimedia capability features There has been the invention of Watchitoo device, which was launched for enterprise purposes, and the Tely HD designed for multiple users for home use. These devices according to review articles    are ultimately designed to allow for live online streaming of calls, pictures and messages for multiple users using their HDTV sets at the comfort of their homes. The Watchitoo device can allow connection of up to 25 users to the device at the same time and enable them make audio or video calls simultaneously. The Tely HD has been designed to allow family members or small groups of friends to convert their HDTV sets into a live chat device. They are capable of making definition video calls through their HDTV at the comfort of their living room without crowding to a small screen3. In addition, an attractive feature with these devices is that apart from traditional feature whereby devices are independent in communication, these devices have been essentially designed to be fully integrated with already established social networking sites and tools. The Watchitoo has been embedded into users own networking site services like Facebook or Twitter. This allows the user to make video calls    and invite friends to chat with them very easily through these sites. The Tely HD has been designed to communicate with all Skype enabled devices in the market. The user can make Skype calls to other Skype enabled devices including other Tely HD televisions, smart phone, personal computers and any other device with inbuilt Skype capability in these devices4.       
Subscribe to:
Comments (Atom)
 
