Kristin Lardners Case Study Essay example - 5934 Words

Kristin Lardner’s Case Study MPA 5400 Public Administration Theory Abstract There are two main theories in public administration that apply to Kristin Larnder’s case study. They are the bureaucracy theory and the client responsiveness theory. In this paper these theories will be discussed in detail as to how they relate to public administration theory. The internal and external environment relationships of Kristin’s case will also be discussed. Public administration affected this case study greatly and there were many factors that could have been prevented, but instead led to Kristin’s murder. There are many theories that ultimately should have been applied to Kristin’s case study that could have prevented her murder. Table†¦show more content†¦Rose Ryan was granted a restraining order against Michael Cartier, but it took the police over a month to pick Cartier up and arrest him. Cartier was in and out of mental hospitals on several occasions and finally he was sentenced to prison for a year, but only had to serve 6 months. He still stalked Rose from prison and he had some of the inmates write her obscene letters. Cartier was released from prison on good behavior, but immediately began violating his probation by injecting a vial of blood into a ketchup bottle in a restaurant. He should have served 6 months in jail for that incident and a burglary incident, but the charges were dropped and he only had to serve 49 days in jail (Stillman, 2010). While dating Kristin, Cartier continued to harass Rose Ryan. Cartier was ordered to appear in the Boston Municipal court for violating his probation and for contacting Ryan while he was still in jail. Instead of being sentenced to serve the year in jail that he received for attacking Rose Ryan with scissors, he was ordered to attend an anger management class called, Alternatives for Violence. It was a six week class that was strictly educational. It did not involve any type of therapy. It taught people how to handle stress without using violence. Cartier showed up for the first class, skipped the second class, and then his probation was revoked for skipping the class. Yet again Cartier had to appear in court

The Common Agriculture Policy ( Cap ) - 1656 Words

1.0 Introduction The Common Agriculture Policy (CAP) started as a simple price support policy in 1962, and has since been a controversial and widely debated topic with many critics questioning the fundamentals of its operations. Additionally, the CAP concerns and has an impact on an array of areas, not simply farming. The policy aims to tackle issues prevalent to the environment from, the effects on the environment and biodiversity to animal welfare and jobs. This report aims to; explain and analyse how and why the CAP was implemented, how it operates, and provide insight into how and why reforms have been carried out with an evaluation of these reforms. 2.0 Background The complexity of CAP can only be grasped with the context of the global dynamics at the time being taken into consideration. World War 2’s widespread atrocities and wartime costs led to the actions of rationing food supplies in Britain. This however, led to the growth of black markets, which would undercut the rationing schemes. The Marshall Plan (insert date), a form of USA intervention, was a program designed to provide assistance to Europe in the form of ‘monetary aid, food, and raw materials. Food security became a prevalent issue in society – this gave birth to CAP, the mechanism of supporting and strengthening Europe’s farming industry. CAP was build on the five primary objectives of; increasing agriculture production, a fair standard of living for farmers, gain stability in the markets, guaranteeShow MoreRelatedThe Common Agricultural Policy1448 Words   |  6 Pagesworkings of the Common Agricultural Policy (CAP) and how and why it was implemented in the European Union. I will explain how the CAP operates, including mechanisms and subsidies. I will be explaining and evaluating how the two CAP reforms have been carried out and if they have been successful or not. 2.0. Findings 2.1. How and why the CAP was implemented The Common Agricultural Policy is the agricultural policy of the European Union (EU) and it is a partnership between agriculture and society andRead MoreReform of the European Common Agricultural Policy989 Words   |  4 PagesEuropean Common Agricultural Policy (CAP) was established in the EU in the late 1960s. It is aimed to support farmers’ incomes while encouraging them to produce high quality food products to meet consumer demand. The CAP protects EU farmers and agricultural producers from global competition in three ways: import tariffs, export subsidies and direct subsidies to inputs and outputs. Since its introduction in the EU the CAP has gradually evolved and adapted to the changing needs of both agriculture and societyRead MoreAgriculture And Its Impact On Economic Development Essay971 Words   |  4 Pages1. Introduction Agriculture is one of the vital sectors in terms of economic development and it is globally one of the most sensitive sectors, since the productivity is comparatively dependence on environment and weather, thereby agricultural product prices are often volatilised; many countries and regions have historically protected this vulnerable sector by variety supports (Tagermann, 2011: 30; Trumbell, 2007). Indeed, albeit agricultural export is recognised as the ‘economic driving force’ forRead MoreThe Beef Market And Its Impact On Beef Production1503 Words   |  7 PagesHere, the beef market, which is one of the largely influenced sectors by the CAP, is exemplified. Beef sector is long-standing tradition, which may primarily have cultural and classical implications, in the EU and subsidies have been historically imposed on beef production, whilst the CAP reforms have tended to reduce this support of beef production (). Owing to it, self-sufficiency accomplishes nearly 100% (Eu ropean Commission, 2015a). Beef is one of the important foods providing multi-nutritionRead MoreA Brief Note On The European Union ( Eu )1461 Words   |  6 Pages1. Introduction Agriculture is one of the vital sectors in terms of economic development and a number of countries tend to rely on their agriculture business for national economies; thereby, it is also one of the most sensitive sectors in the world. Under this circumstance, the European Union (EU) is the biggest food supplier. Since the establishment of European trade bloc in the 1950s, the EU has been playing a significant role in international trade. Particularly, this on-going widened and deepenedRead MoreMarket Intervention1537 Words   |  7 Pagesleft. Intervention schemes are market support measures that help to stabilise the prices of certain products. Government and some organizations have adopted the Buffer Stock Scheme in stabilising price in some of their economics sectors, such as CAP within the European Union. Therefore the government may adopt a system of rationing, where it’s a restriction on the amount of goods that people are allowed to buy. But, However, a problem may arise; maximum prices is likely to be emergence of ‘blackRead MoreThe European Union ( Eu )1294 Words   |  6 Pageshas since become an economic union, where members have free trade, a common currency, free movement of labour and capital and common external trade policies. The agriculture sector currently makes up 1.6% of GDP and 5% of the workforce (Central Intelligence Agency, 2016). However, agricultural GDP has been declining over the years, due to support policy changes and greater prosperity of other sectors. The importance of agric ulture varies considerably from country to country within the EU as shown inRead MoreStructure And Policy Of Cap2702 Words   |  11 PagesStructure and Policy of CAP The Common Agricultural Policy (CAP) is the most complex example of common policy in the European Union. Introduced from 1958 to 1968 and still in existence today, it has brought controversy, dispute and political tension within the EU and with the rest of the world. It is also a remarkable example of the movement toward the unknown realm of integration in Europe. However, subsequent reforms have been slow in arrival and have not always achieved the success expected ofRead MoreEu Is The Largest Gdp Development Economy Group Essay1133 Words   |  5 Pagesnumber of agribusiness employments. Also, EU has compared better agriculture supply chain which providing verity agribusiness production to domestic and international markets. In addition, it is necessary to notice there is a huge market which could be an opportunity to export. As a unit, EU successfully supports their local farmers and development of agriculture. However, it still gets some issues which challenge their agriculture in future. Economic Background As an important economy group,Read More Structure and Policy of the European Union Essay example2696 Words   |  11 PagesStructure and Policy of the European Union The Common Agricultural Policy (CAP), is the most complex example of common policy in the European Union. Introduced from 1958 to 1968 and still in existence today, it has brought controversy, dispute and political tension within the EU and with the rest of the world. It is also a remarkable example of the movement toward the unknown realm of integration in Europe. However, subsequent reforms have been slow in arrival and have not always achieved

Business Employment Commissions

Question: Describe about the Report for Business Employment Commissions. Answer: 1. Ordinary income Income is classified as ordinary when it realized after a short period of time i.e. not exceeding twelve months. These incomes include wages salaries from employment, commissions, incentives, tips, dividends, interests, rents, royalties and winnings from gambling. Also gains from sale of an asset held less than one year also referred as short term capital gains are treated as ordinary income. Income realized after a long period of time e.g. the sale of assets like a piece land and a house is treated as capital gains(Morgan et al, n.d.). Another case where income is not treated as ordinary income is qualified dividends, where the company includes the tax in their own taxable income. In summary ordinary income is any other income that is not a long-term income/capital gains. Peta acquired the property that comprised of a house and two old tennis courts two years ago. Two years later she invested on renovation of the tennis courts in order to sell them to the tennis club. The oldtennis courts plus the house are considered as one property since they are on the same piece of land that was bought two years ago, according to the taxation law, ordinary income is that which is realized after a period less than a one year. Petas property of $600,000 receipt will not be categorized as ordinary income. Reason being the part of the property was disposed two years later. The income however it qualifies as capital gains since the renovation of the courts can only be termed as value addition on property. For the case where Peta planned to construct three units and sell them at a profit, the revenue gained from such activity would also be treated as capital gains since the two years had already passed by (Freebairn, 2016). However, if Peta had acquired the property and in the same year sold the two tennis courts to the tennis club, the receipt would have been treated as ordinary income. 2. Fringe benefit tax (FBT) This is a form of tax that is liable to a company due to benefits that it extends to its employees. For example rights, privileges, services and facilities that can be expressed in monetary terms (Bebbington, 2009). The most common types of fringe benefits that companies extend to their employees include, car fringe benefits, car parking fringe benefits,,expense payment fringe benefits, loan fringe benefits, debt waiver fringe benefits, housing fringe benefits, board fringe benefits and living away from home allowance fringe benefits(Ato.gov.au, 2016). In our case we will also be dealing with entertainment fringe benefit. Usually it is quite hard to determine the fringe benefit on entertainment, since not all the time a company is able to tell the exact number of occasions to be held throughout the year or even the number of attendees. Therefore, various methods that have been put in place to help estimate the fringe benefit tax, but we shall focus on only three of them that are most common.They include; The 50/50 method This method assumes that when providing entertainment, half of the food and drinks will be taken by employees while the other half goes to the partners, clients or spouse. The method is mostly used when a company does not have all the attendant data or it is unable to estimate the number of attendees. The actual method It is applied when the organization in question is at a position to determine the number of attendants in a particular event to be held during that particular year of fringe benefit tax. It calculates the actual taxable value based on actual expenditure. This is the most suitable method as it saves cost and helps in smoothening the planning of the occasion. The 12-week register method The 12-week register involvesfollowing the taxable amount of each employeefringe benefit. It focuses on the percentage of meals and entertainment provided to employees against non- employees as itemized with in a register or log for 12-week representative period. The following considerations are to be considered to determine whether the fringe benefit tax is to be applied or not; When the company organizes an entertainment of food and drinks that are to be consumed on business travel away from home, it will not attract fringe benefit tax. In occasions where the company conducts a seminar, the food and drinks expense is deemed as fringe benefit but not taxed. Where the company provides food and drink to employees during working days in recognizable dining place. Employees may sometimes be overwhelmed by work and the company is forced to provided overtimemeals, such meals do not attract fringe benefit tax. If the entertainment takes place in a work day (in-house, meetings) to employees, the event will not attract fringe benefit tax When the entertainment is for clients,whether the event takes place in-house or outside, fringe benefit tax does not apply In case the company provides food and drinks to suppliers and partners whether the event is in house or outside premises, the event is subject to fringe benefit tax. Fringe benefit tax will apply when the entertainment involves employees, clients, suppliers, family members and avenue outside work place. However exemptions are made to minor benefits. Entertainment involving food and drinks with a value less than $300 per employee is not taxable. Though this should not be frequent or regular otherwise it will be taxed. Alsoentertainment provided by charitable organizations do not attract fringe benefit tax In order to estimate the fringe benefit tax on entertainment that ABC Company is liable, we will employ the 50/50 method. Good and services tax (GST) Goods and services tax is levied at every stage of purchase or selling of goods or exchange of services, and is commonly regarded as value added tax (VAT) in some countries (Morgan et al, n.d.).This kind of tax allows registered businesses organizations to claim tax refund on goods and services tax of goods they purchased and are yet to be sold for instance when a business entity purchases products that are goods and services tax inclusive and latter sell a particular portion of the same goods in a particular year, the business has a right to claim a tax refund for the goods not sold(Austlii.edu.au, 2016). The goods and services tax is hard to distinguish at every stage on the supply chain and therefore it has a single rate all through till the goods or services get to the end consumer(Ato.gov.au, 2016). The main objective of goods and service tax is to avoid double taxation and improve efficiency in tax collection. The following calculations will be undertaken to determine the goods and service tax to be included in the fringe benefit tax I order to calculate the goods and services tax payable on fringe benefit tax we follow the below steps Take the total value of fringe benefits that each employee enjoys Subtract any benefits which are exempted or zero rated for goods and services tax, such as low-interest loans, international travels and contribution to employees insurance policy. Multiply the results from step 2 by 3 and divide by23, the result is the amount ongoods and services taxadjustment to include in your fringe benefit taxreturn. Step 1: Add all fringe benefits Payment ofAlan mobile phone bill for a year$220*12= $2,640 in a year Alans children school fees $ 20,000 ABC companyPurchase of latest mobile handset for Alan $ 2,000 Cost of dinner$ 6,600*50 % (entertainmentfringe benefit tax)= $3,300 Total fringe benefits$27940 Step 2: Less any fringe benefits that are goods and services tax free. Total fringe benefits $27940 Less childrens school fees $ 20,000 Fringe benefit tax amount $7,940 Step 3 Determination of goods and services tax to be included on fringe benefit tax. To obtain this, we firstmultiply $7,940 by 3 = $23,820 The result is then Divide $23,820 by 23 = $1035.65 According to the above calculations the goods and services tax adjustment to be included in the fringe benefit tax return by the ABC Company as of 31st March 2016 is $1035.65 (b)If the ABC Company had hosted the dinner for only5 employees the expensewould still be taxed since their partners would also attend.If the 5 employees only were to go for the dinner in the same restaurant, taxation would apply since it is an outside venue. On the other hand if the dinner was only for five employees and the expenditure per employee would be below $300, goods and services tax inclusive,the fringe benefit tax would not be put in place since the law has already exempted it. (c)In the case where clients had to attend the dinner together with the employees and partners, the fringe benefit tax would remain the same as in part a above since entertainment for clients is exempted from taxation though it would be hard to determine the exact amount that the client would consume. If the company had to arrange the dinner at the same restaurant for its clients only, then the entertainment would not attract the fringe benefit tax. Also if the same entertainment was to be held within the companys premises the fringe benefit tax would not apply. References Austlii.edu.au. (2016).A NEW TAX SYSTEM (GOODS AND SERVICES TAX) ACT 1999.: https://www.austlii.edu.au/au/legis/cth/consol_act/antsasta1999402/ Ato.gov.au. (2016).Fringe benefits tax (FBT) | Australian Taxation Office. [online] Available at: https://www.ato.gov.au/General/Fringe-benefits-tax-%28FBT%29/ Ato.gov.au. (2016).GST | Australian Taxation Office: https://www.ato.gov.au/Business/GST/ Ato.gov.au. (2016).Entertainment and fringe benefits | Australian Taxation Office: https://www.ato.gov.au/General/Fringe-benefits-tax-%28FBT%29/Types-of-fringe-benefits/Entertainment-and-fringe-benefits/ . Bebbington, P. (2009). Fringe benefit.New Scientist, 203(2724), p.27. Freebairn, J. (2016). Taxation of Housing.Australian Economic Review, 49(3), pp.307-316. Morgan, A., Mortimer, C. and Pinto, D. (n.d.).A practical introduction to Australian taxation law. Stenkula, M. (n.d.).Taxation of Goods and Services from 1862 to 2010.SSRN Electronic Journal. Woellner, R. (2013). Australian taxation law 2012. North Ryde [N.S.W.]: CCH Australia.

Utopia or dystopia free essay sample

â€Å"The Giver† by Lois Lowry is like any other novel and to every novel there are two ideas and concepts that you may apply to the novel; the one each person thinks of is determined by the different clarification and interpretation the book. In analysis of the building of Jonas’s community, some may debate that the community is a utopia or a dystopia. Some may claim of it being a utopia based on the way that they want their world to be and that is different based on each ones opinion of a utopia, while others may argue of it in being a dystopia and claiming that it is not fit for living, maybe someone has a good point there. There are different things in the normal community than in Jonas’s community some may be good and some may be bad. The Givers community is particularly different than our own community; again everyone has their own definition of the word normal in this world. We will write a custom essay sample on Utopia or dystopia or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page Jonas’s community may differ from many communities based on a few points, one of these points is that they are always under surveillance and no one is ever alone and you can never do anything without the people knowing; of course the Givers room is an exception. Like when Jonas said that he was starving and they heard him over the microphones. They have all their lives planned out since the moment they are born; even the facts that they don’t even go to live with their birthparents, they even have a ceremony that they get to receive things in and where they claim their jobs. Then all throughout the years they can never do anything that is against the rules and they would get punished if they do, the punishment isn’t even decided by the parents its decided by the even use of excessive language and over exaggerated language is not allowed, once again just like what happened with Jonas in the cafeteria when he stated that he was hungry. Once they have grown old, like elderly not just adults, they get a treatment like the kings and queens; the job that his friend had there, Lowry tried to show how much relaxation that they have by writing a part stating that they were giving a shower to the elderly. The way that his community is described throughout the book may perhaps create a controversy on whether or not its a utopia. People have numerous ideas of what a perfect world is made up of; a handful of these may fit in with Jonas’s community making it a utopia. What is a utopia made up of? Well no one can actually tell you; each person has their own philosophies. You will never have everyone on the same page, perhaps the fact that everything provided there makes it a utopia. People get food, drinks, clothes and everything else they need, Lowry even got a part where it was said that they receive all meals all the time and that they are never hungry nor thirsty, What more would a person want? They get to go to school and they get jobs and they even train them to make them ready and perfect for their jobs, these jobs are all assigned to them at the ceremony of twelves and then they even get their own teacher, not like a real teacher but like a mentor. Once they get older they are treated miraculously and like royalty and get everything they need until it’s their time to go, they even get volunteers to give them showers and help them all the time at whatever time they need. But perchance this idea is wrong; maybe the community isn’t just fit to be a utopia and is a dystopia. On the contrary to what was claimed beforehand Jonas’s community might as well be a dystopia. There are numerous concepts that make the community a dystopia. One of the things is that they are always under observation, which is why Jonas could not even talk to himself about his training at his own room, they can never have a moment of peace and they are never able to actually talk about certain things since its not appropriate for them; but what is inappropriate? They claim that some things might be inappropriate but maybe they are just over doing it. They are always trying to be in total control of everyone and there is always surveillance everywhere. As it was mentioned before everyone’s life is planned out from the moment they are born. They dont get an opinion in almost anything. Not even their jobs, they just put each person into the job that they think is right for them and not the job that they actually want, in the ceremony of the twelves this is all decided then. They took away all the color so that everyone is the same and no one has something better than the others even though they may deserve it, that’s why Jonas felt that something was wrong with the apple when he suddenly saw it turning red (he started seeing the color for the first time) when it was in midair. The debate on whether or not Jonas’s community is a utopia or a dystopia can run forever, each person has their own idea of normal. This novel was strongly filled with different ideas and each person can dismantle them and label the community as a utopia or a dystopia. Each person is different so the ideas will be different and also that there are people who would dismantle the story and the ideas differently. The two main ideas are whether or not its a utopia or a dystopia. Each of these different opinions is stated all throughout.

Evolution Of The Power Of The Presidency Essays -

Evolution Of The Power Of The Presidency The views of the presidency by the first sixteen presidents varied widely but all of their actions set precedents for their successors to use, expand, or even curtail the power of the office. Some believed in the Whig theory of strict adherence to the constitution, while others believed the president was the steward of the people with a loose interpretation of it. The power of the office expanded through the years, however it only expanded as far as the public and congress allowed. George Washington was the first President of the United States of America and realizing this he acted carefully and deliberately, aware of the need to build an executive structure that could accommodate future presidents. Washingtons position as the first president of the United States allowed him to set many precedents that are still followed by executives today. Washington believed his power came from article II of the U.S. Constitution. He was very protective of executive powers and did not involve the executive branch in legislative matters. He established the initial implied powers of the president by creating the national bank, excise tax, and assumption of state debts from the Revolutionary War. The creation of those bureaucracies set the precedent that allowed presidents after him to establish and empower new bureaucratic agencies to execute the duties of the executive office. Thomas Jefferson was the third president of the United States and viewed the office of the president to be strictly constructed by the constitution. He, like Washington, believed his power as president derived directly from the constitution and the affection of the people. Although he had a Whig theory he made the Louisiana Purchase in 1803, which the president had no authority according to the constitution to do; the congress has control of the purse strings according to the constitution. President Jefferson was the first to pass out the rewards of the spoils system. In his second term he became the first President to use economic sanctions against a foreign power, with the embargo act of 1807, in order to achieve a goal. With the exception of the Louisiana Purchase, Jeffersons administration was a negative presidency in that it rolled back federal policies. His economic policies enabled future presidents to use the foreign treaty powers as a weapon in diplomatic negotiations with o ther countries without interference from congress. In the election that ended the Era of good feelings(1824) John Q. Adams won the presidency. While he was not a very powerful president himself, he is responsible for the beginning of the legislative role of the presidency. He believed the role of the president was to be a steward of the people and favored a loose interpretation of the constitution. He advocated internal improvements such as better roads, canals, schools, and a better army and navy. The action of Adams in an attempt to get the federal government to finance those projects is the basis that is used to legitimize federal funding even today. Andrew Jackson is arguably one of the most influential presidents in history. He believed that government had a social obligation to the people and that it was the most democratic branch. He was the first president to create a grassroots political party and used its strong public support to tie the Electoral College to the popular vote among other things. He used the power of the presidency in a manner that no previous president had by influencing legislation with threat of a veto. James K. Polk is the first dark horse candidate to win the presidency and in spite of this fact he was still able to significantly expand the power of the office. He believed in being a steward of the people and maintaining strong executive power. By paying close attention to the budget and setting a budgetary agenda he was able to increase the power of the presidency and started an era of administrative presidents that still exists today. Abraham Lincoln was the last president in the 19th century to further expand the power of the presidency. Because he was a member of the minority party with a divided cabinet and only received 40% of the popular vote had to rely

Phenylalanine hydroxylase (PAH) Gene Essay Example

Phenylalanine hydroxylase (PAH) Gene Essay Example Phenylalanine hydroxylase (PAH) Gene Paper Phenylalanine hydroxylase (PAH) Gene Paper Phenylalanine hydroxylase (PAH) Gene Background: Phenylalanine hydroxylase (PAH) encodes the liver-secreted enzyme of the same name, a catalyst for the hydroxylation of tyrosine from phenylalanine, a rate-limiting step in the catabolism of the latter. This reaction only occurs in the presence of the cofactor tetrahydrobiopterin (BH4) as well as molecular oxygen and iron (1). Mutations in the PAH gene are generally caused by a change of an amino acid, for example, the change of arginine to tryptophan (2, 3). The numerous possible mutations in this gene result in a lack of enzyme activity. Thus, because of its main function, the deficiency in the activity of PAH causes a marked intolerance of the consumption of phenylalanine, an essential amino acid. This causes phenylketonuria (PKU), non-phenylketonuria hyperphenylalaninemia (non-PKU HPA), mild hyperphenylalaninemia (MHP), and other variant PKU (4, 5, 6). Defects in the PAH gene leads to the deficiency or the disruption of the production of the PAH enzyme; this is most commonly related to the resulting disorder, phenylketonuria. PKU is an autosomal, inborn, recessive disorder of phenylalanine metabolism (7). There are three common types of PKU. First, there is classical PKU, caused by the mutation of both alleles of the PAH gene in chromosome 12 which results in a severe deficiency or complete absence of the PAH enzyme, leading to toxic levels of unhydroxylated phenylalanine, typically over 10 times higher than normal concentrations (i.e. over 1000  µmol compared to the normal 100  µmol). Next, there is MHP, the mildest form of the PAH enzyme deficiency, with phenylalanine levels below 600  µmol but above normal. Thirdly, there is non-PKU HPA, caused by mutations in the PAH locus that hinder BH4 synthesis and regeneration. This relatively milder form of the disorder often results in heterozygous cases through a combination of mi ld and severe mutations (4, 7, 8). Severe classical PKU, if left untreated, is commonly known to result in the impedance of postnatal cognitive development causing mental retardation and in metabolic abnormalities causing increased phenylalanine in in the blood circulation and phenylpyruvic acid in the urine. PKU has also been known to cause skin abnormalities, organ damage, different kinds of posture peculiarities, pregnancy problems (maternal PKU), an odor describe as â€Å"mousy†, as well as other mental issues such as epilepsy, hyperactivity, and psychotic episodes (1,4,7,8). The most common negative effect associated with PKU, mental retardation, is caused by a neurotoxic effect of HPA. And while PKU is an inherited disorder, its negative effects could also be induced in the offspring of mothers with PKU, resulting not only in high fetus mortality rates but also in a high probability that the children are born with growth and mental retardations as well as malformations. This is known as PKU embryofetopath y or maternal PKU syndrome (8). Conversely, children born with non-PKU HPA and MHP have marked lower risks of being affect with the adverse effects of the disorder and can have normal development mentally and physically even with the absence of treatment (4,8). Despite the severe potential effects of classical PKU, newborn screening for high levels of phenylalanine has helped early diagnosis of the disorder, which is then followed by rapid treatment. Dietary restrictions of phenylalanine has been used for early treatment of PKU which, while not necessarily lead to complete normalization of IQ, was shown to be predictive of overall IQ with the complete lack of treatment in classical PKU patients leading to severe and irreversible cognitive retardation.(1,8) Thus, primary screening of neonates and children as well as awareness of the disorder for the parents are essential (3, 6). Results and Discussion: PAH chromosomal map position and nearby genes: The location of the PAH gene is at chromosome 12. Its long arm (q) is comprised of 13 exons with an approximate length of 90 kb. Figure 1 Chromosome 12 (9) Figure 1, above, is a representation of the entire chromosome 12 with both its short arm (p) and long arm (q) as it appears in the Ensembl website, albeit cropped to fit the page. This figure can be found by searching for the PAH gene and clicking on the â€Å"Location† link on the PAH listing. The website lists the location of the gene to be at â€Å"Chromosome 12: 103,232,104-103,311,381 reverse strand.†(2) Though the website does not explicitly state where in chromosome 12 PAH is located, one can infer additional details from the provided images. For example, confusion can ensue from the fact that the indicated location in the image in the Ensembl website is on the long arm on q23.2, while previous sources have stated that it is located on q22-24.2. However, from the code in the location and the additional images, one can infer that these are the transcribed portions of the gene, two of which are illustrated in the site. Furthermore, one can see that the PAH gene is flanked by the genes insulin-like growth factor 1 (IGF1), or somatomedin C, and achaete-scute complex homolog 1 (ASCL1). To obtain the information, though, one needs to explore the interactive image (see Figure 2 below) and go to the individual pages of the neighbor genes. Figure 2 Detailed view of region near PAH (9) The NCBI website, however, while very extensive in details, and containing multiple transcripts pertaining to the PAH gene, can be somewhat confusing with regard to the Map Viewer. Going through the home page and directly searching for the desired gene results in a very large and confusing map, with the details of the gene and its neighboring gene beyond the page to right. For a beginner who is not quite sure what to look for, the NCBI Map Viewer can be very overwhelming. Focusing on the table and not the map, however, one can see that the PAH gene is located in Chromosome 12, in the long arm q22-q24.2; this information is under the heading â€Å"Cyto† (for cytogenic) and stated as â€Å"12q22-q24.2† (10). Again, this might not be immediately clear to a beginner. Furthermore, the different master map options (Morbid, Gene_cyto, etc.) individually show different arrangements of the symbols, not all of which seem to be genes. Thus, it is very hard to decipher which genes are actually near PAH, although zooming in on the â€Å"Genes on Sequence† and â€Å"Phenotype† maps do reveal the proximity of IGF1 and ASCL1. In all, for a beginner, the Ensembl website proved to be much easier to use to answer the first question. The intron/exon structure of the PAH gene: It was very difficult to find an illustration of the structure of the PAH gene in the NCBI website. However, the information page for the gene stated that the gene spans 90 kb with the entire sequence and its adjacent regions a total of 171 kb. Furthermore, it states that the gene contains 13 exons, which consequently means that it has 12 introns (number of introns is one less than the number of exons) (1). After some searching, however, beginning with clicking the available links for PAH in the Map Viewer table, the link â€Å"sv† led to a page with the title â€Å"Homo sapiens chromosome 12 genomic contig, GRCh37 reference primary assembly.† Searching for the gene gives the following (zoomed-in and cropped) structure:   Figure 3 Structure of PAH gene (11) Though not obvious from the first glance, later we will see that the bottom sequence actually represents the structure of the PAH, with the vertical green lines representing the 13 exons. After further searching, the following (rotated) PAH structure showing the 13 exons and 12 introns can be found in the Map Viewer under â€Å"ensRNA†:   Figure 4 Another illustration of the structure of PAH gene (11) Finding those, however, takes previous explicit knowledge and some work to track down the specific illustrations. In contrast, finding the number of exons and introns and an illustration of the structure of the PAH gene in the Ensembl website was very straightforward. The following illustration can be found in the same page as Figure 1: Figure 5 Ensembl illustration of PAH gene structure This strand, one of the transcripts available in the Ensembl page, clearly shows the 13 exons in a DNA sequence. Comparing this structure to Figures 3 and 4, the numbers and the arrangements of the exons and introns are exactly the same. However, relative to all the tedious searching needed to find the same answers in the NCBI website, the information needed for the question was instantly available from the Ensembl site, and the interface was very easy to understand. Common PAH mutations: Mutations in general can refer to abnormalities in function or structure of the concerned enzyme in the gene phenotype. As previously discussed, however, such as the causes of PKU and HPA, the human PAH gene has displayed allelic differences and pathogenic transformations throughout its structure. The common types of mutations and their occurrence according to a previous study are: missense mutations with 62% of the alleles, small or large deletions with 13%, splicing defects with 11%, silent polymorphisms with 6%, nonsense mutations with 5%, and insertions with 2% of the PAH alleles. (6) Table1 PAH mutation statistics Mutation Type: # of Mutation(s) Missense 336 Deletion 73 Splice 62 Silent 32 Nonsense 28 Insertion 10 Sil./Splice 3 Unknown 3 Total mutations: 547 Most reported Mutation (Association): p.R408W (214) Missense, as can be seen above, is the most common cause of mutation in the PAH gene, the molecular mechanism of this is the improper folding of the protein structure, causing aggregation or degradation. As mentioned earlier, the mutations of PAH are commonly caused by single changes in the amino acid. One of the missense mutations, for example, occurs in E1 nucleotide 1 with the change of ATG to GTG. However, there is also missense mutation in region E3 with sequence 187.000 in nucleotide 187; this is called ACC/CCC;CAC/AAC. The second most common type of mutation is deletion. An example of deletion mutation is in regions E2-12 with sequence 168.001 in nucleotide 168. This is called GAG/GAA;G/A and has been noted to have occurred in Palestinians Arabs. (2, 3, 12)   Other examples can be seen in Appendix (I). As mentioned earlier, there are three common variations of PKU: classical PKU, MHP, and non-PKU HPA. These variations which are basically different degrees of severity of the disorder are caused by the different kinds of mutations that cause varying PAH activity as well as allelic variations. The latter effect at the locus of the gene determines the metabolic phenotype of the enzyme deficiency. In general, however, the mutations in the PAH gene are localized in a main part of the gene instead of being randomly distributed, as they occur either within or without the active site. What is interesting to note is that the PAH gene in intron 12 involves the single base change of guanine to adenine in the canonical 5-prime splice donor site where the first identified PKU mutation occurred. (3) Two out of the 6 links given by the Gene Gateway page were no longer working, one was solely dedicated to SNP, one was a link to a database that had links to other databases, and the last two were already explored thoroughly in previous parts of this assignment. The data presented in this section were mostly from the entire site dedicated to PAH gene mutations, the Phenylalanine Hydoxylase Locus Knowledgebase (5). This site, also a database, was arrived at after searching through the Locus Specific Mutation Databases which in turn arrived at from Human Genome Variation Society: Variation Databases and Related Sites. While the OMIM site did give some details about previous studies related to PAH gene mutations, they were more of a history of the mutations and examples of the studies. Finding the needed information was difficult because one needed to go through link after link and website after website, sometimes even arriving at the same website numerous times through different pathwa ys and still not obtaining any results. The PAHdb was by far, the only site that showed any data regarding the common mutations. Single nucleotide polymorphisms (SNPs) of the PAH gene: To date, 1220 SNPs for the PAH gene have been discovered, although GeneCards (2) states only 1097 from the NCBI website. In general, the SNPs involve the changing of a single base, as shown in Appendices I and II. Examples are the three found on exon 3, each of which has a single change of base, name cytocine, thiamine, and adeninine(13). Examples of these PAH gene SNPs are the rs63749677, rs63749676, rs63581460 and rs63499960; some of these are tabulated in Appendix (II). These SNPs are not randomly distributed as out of the 13 exons, they are seen in exons 1-7 and 12. Searching the NCBI website, however, resulted in 55 entries of SNPs with the following format: rs79931499 [Homo sapiens] CAATCCTTTGGGTGTATGGGTCGTAG[C/G]GAACTGAGAAGGGCCGAGGTATTGT 12 The above entry, an example of the results from the query in the NCBI SNP website, shows essential information about the SNP as well as options one can view. Compared to the other related links, which did not yield any useful information other than linking back to this site, the NCBI site dedicated purely to SNPs was simple and the information was easy to retrieve. Due to the very large number of SNPs, however, it would be difficult to evaluate all of them. Designing PCR primers: The given instructions and the program given in the website were rather straightforward, so the designing of the primer was the easiest part of the activity. The mRNA sequence was easily downloadable and the program was user-friendly (14). Being able to design primers this way was very fast and easy. The resulting primers are in Appendix (III). References: 1. [26/08/10]; Available from: ncbi.nlm.nih.gov/omim/612349 2. Hoeks M, den Heijer M, Janssen M. Adult issues in phenylketonuria. The Netherlands journal of medicine2009;67(1):2. 3. [21/09/09]; Available from: ensembl.org/index.html. 4. [26/08/10]; Available from: genecards.org/cgi-bin/carddisp.pl?gene=PAHsearch=pah#loc 5. [26/08/10]; Available from: pahdb.mcgill.ca. 6. Carter K, Byck S, Waters P, Richards B, Nowacki P, Laframboise R, et al. Mutation at the phenylalanine hydroxylase gene (PAH) and its use to document population genetic variation: the Quebec experience. European Journal of Human Genetics1998;6(1):61-70. 7.   [26/08/10]; Available from: ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gndpart=phenylketonuria 8. [26/08/10]; Available from: ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=genepart=pku 9. [26/08/10]; Available from: ensembl.org/Homo_sapiens/Location/View?db=core;g=ENSG00000171759;r=12:103232104-103311381;t=ENST00000307000 10. [26/08/10]; Available from: ncbi.nlm.nih.gov/projects/mapview/maps.cgi?taxid=9606chr=12MAPS=pheno,morbid,genec,decode,ensrna,ensgenes,rnaRn,rnaMm,rnaHs,rnaGga,rnaBt,gbdna,rna,ugHs,genes-rcmd=focusfill=80query=uid(136508683,136446655,12845117,12579049,8990832,717234,698472,11088097,11049717,6481463,570698,568170,34586070,16320694,13572526,34590012,128619463,415205)QSTR=pah 11. [26/08/10]; Available from: ncbi.nlm.nih.gov/projects/sviewer/?id=NT_029419.12v=65375409..65454686 12. *Robin A Williams, 2 Cyril DS Mamotte,2 *John R Burnett1,3. Phenylketonuria: An Inborn Error of Phenylalanine Metabolism 13.  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚      [updated 21/09/09]; Available from: ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=5053 14.  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚      [21/09/09]; Available from: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi Appendices: Appendix (I) Examples 1. Systematic Name: c.1AG Region: E1 Reference (1st): Mutation Name: p.M1V Sequence: 0.000 JOHN SW, ROZEN R, LAFRAMBOISE R, LABERGE C, SCRIVER CR: Novel PKU mutation on haplotype 2 in French-Canadians. Am J Hum Genet 45:905-909, 1989 Other Name: ATG/GTG Length: 1 Nucleotide No.: 1 Rest. Site: -Xba I Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 2. Systematic Name: c.3GA Region: E1 EIKEN HG, KNAPPSKOG PM, APOLD J, SKJELKVÃ…LE L, BOMAN H: A de novo phenylketonuria mutation: ATG (Met) to ATA (Ile) in the start codon of the phenylalanine hydroxylase gene. Hum Mut 1:388-391, 1992 Mutation Name: p.M1I Sequence: 3.000 Other Name: ATG/ATA Length: 1 Nucleotide No.: 3 Rest. Site: -NspI Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 3. Systematic Name: c.117CG Region: E2 FORREST SM, DAHL HH, HOWELLS DW, DIANZANI I, COTTON RGH: Mutation detection in phenylketonuria by using chemical cleavage of mismatch: Importance of using probes from both normal and patient samples. Am J Hum Genet 49:175-183, 1991 Mutation Name: p.F39L Sequence: 117.000 Other Name: TTC/TTG Length: 1 Nucleotide No.: 117 Rest. Site: -MboII, +MaeIII Mutation Type: Missense Syst. Name gDNA: Erlandsen H, Pey AL, Gmez A, Pà ©rez B, Desviat LR, Aguado C, Koch R, Surendran S, Tyring S, Matalon R, Scriver CR, Ugarte M, Martà ­nez A, Stevens RC.: Correction of kinetic and stability defects by tetrahydrobiopterin in phenylketonuria patients with certain phenylalanine hydroxylase mutations. Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No Appendix (II) SNPs of the PAH gene Region Contig position mRNA pos dbSNP rs# cluster id Hetero- zygosity Function dbSNP allele Protein residue Codon pos Amino acid pos exon_12 26716405 1750 rs59326968 N.D. synonymous C Asn [N] 3 426 contig reference T Asn [N] 3 426 exon_7 26728783 1314 rs5030851 N.D. missense T Leu [L] 2 281 contig reference C Pro [P] 2 281 exon_6 26731200 1061 rs5030653 N.D. missense (22bp) [CIKPMLAN] 1 197 frame shift -/TGTATAAAACCCATGCTTGCTA 1 197 contig reference (22bp) [LYKTHACY] 1 197 26731262 1020 rs17852373 N.D. missense G Gly [G] 2 183 contig reference A Glu [E] 2 183 exon_3 26770856 671 rs5030842 N.D. missense C Pro [P] 1 67 contig reference T Ser [S] 1 67 contig reference A Ser [S] 3 36 exon_1 26793098 474 start codon 1 Appendix (III) Designed Primers Exon1 ENSE00001141448 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG PCR primer design: No mispriming library specified Using 1-based sequence positions OLIGO  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚     seq LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  369  Ã‚   20  Ã‚   59.83  Ã‚   55.00   6.00   2.00   Ã‚  TCCTCCCTAGTGCGAGGTTA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚     522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   3.00   2.00   Ã‚  CAGAGAGTTTCCTGCCCAAG SEQUENCE SIZE: 533 INCLUDED REGION SIZE: 533 PRODUCT SIZE: 154, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 3.00 1 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT 61 TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC 121 TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG 181 CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG 241 CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA 301 CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA 361 CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC 421 TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA 481 CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  Ã‚  Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     seq 1 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  339  Ã‚   20  Ã‚   59.77  Ã‚   50.00   Ã‚  3.00   Ã‚  1.00  Ã‚  Ã‚     ACGCAAGAGACACCCTTTGT RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   Ã‚  3.00   Ã‚  2.00   Ã‚  Ã‚  Ã‚  Ã‚  CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 184, PAIR ANY COMPL: 6.00, PAIR 3 COMPL: 2.00 2 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   318  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   2.00 GTTACTGTGCGGAGATGCAC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   3.00   2.00 CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 205, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 3 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   157  Ã‚   20  Ã‚   60.07  Ã‚   55.00   2.00   0.00 CTGGCTTCTTCCCTTTACCC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   337  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 181, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   156  Ã‚   20  Ã‚   60.07  Ã‚   55.00   3.00   0.00 CCTGGCTTCTTCCCTTTACC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   337  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 182, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 Statistics con  Ã‚   too  Ã‚  Ã‚   in  Ã‚  Ã‚   in  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   no  Ã‚  Ã‚   tm  Ã‚  Ã‚   tm   high   high  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   high sid   many  Ã‚   tar   excl  Ã‚   bad  Ã‚  Ã‚   GC  Ã‚   too  Ã‚   too  Ã‚   any  Ã‚  Ã‚   3   poly  Ã‚   end ered  Ã‚  Ã‚   Ns  Ã‚   get  Ã‚   reg  Ã‚   GC% clamp  Ã‚   low   high compl compl  Ã‚  Ã‚  Ã‚   X   stab  Ã‚  Ã‚   ok Left  Ã‚  Ã‚   3637  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   162  Ã‚  Ã‚  Ã‚   0  Ã‚   419   2558  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   2  Ã‚  Ã‚   22  Ã‚  Ã‚   73  Ã‚   401 Right  Ã‚   3701  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   130  Ã‚  Ã‚  Ã‚   0  Ã‚   321   2817  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   2  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   78  Ã‚   353 Pair Stats: considered 140, unacceptable product size 129, high end compl 3, ok 8 primer3 release 1.1.4 KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     seq 1 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00   Ã‚  Ã‚  Ã‚  GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   265  Ã‚   20  Ã‚   58.12  Ã‚   40.00   3.00   0.00   Ã‚  TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 247, PAIR ANY COMPL: 2.00, PAIR 3 COMPL: 0.00 2 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00  Ã‚     GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   260  Ã‚   22  Ã‚   60.05  Ã‚   40.91   4.00   0.00   Ã‚  GATGACCCCAAAAGATTTACCA PRODUCT SIZE: 242, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 3 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   45  Ã‚   20  Ã‚   60.39  Ã‚   50.00   6.00   1.00  Ã‚     AGCCATGGACAGAATGTGGT RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   265  Ã‚   20  Ã‚   58.12  Ã‚   40.00   3.00   0.00   Ã‚  TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 221, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00   Ã‚  Ã‚  Ã‚  GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   258  Ã‚   20  Ã‚   57.92  Ã‚   40.00   4.00   0.00   Ã‚  TGACCCCAAAAGATTTACCA PRODUCT SIZE: 240, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 Statistics con  Ã‚   too  Ã‚  Ã‚   in  Ã‚  Ã‚   in  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   no  Ã‚  Ã‚   tm  Ã‚  Ã‚   tm   high   high  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   high sid   many  Ã‚   tar   excl  Ã‚   bad  Ã‚  Ã‚   GC  Ã‚   too  Ã‚   too  Ã‚   any  Ã‚  Ã‚   3   poly  Ã‚   end ered  Ã‚  Ã‚   Ns  Ã‚   get  Ã‚   reg  Ã‚   GC% clamp  Ã‚   low   high compl compl  Ã‚  Ã‚  Ã‚   X   stab  Ã‚  Ã‚   ok Left     Ã‚  7708  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   791  Ã‚  Ã‚  Ã‚   0   4562  Ã‚   600  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   14  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   52   1689 Right  Ã‚   7734  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0   1269  Ã‚  Ã‚  Ã‚   0   4609  Ã‚   311  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   6  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   44   1495 Pair Stats: considered 2222, unacceptable product size 2195, high end compl 6, ok 21 primer3 release 1.1.4

Management Information System Essay Example | Topics and Well Written Essays - 1250 words

Management Information System - Essay Example The Watchiloo has been designed as an embedded player for social network sites to allow for users to access advanced features. The first part of the article shall analyze how these devices can be used to communicate with their advanced features. The article shall also cover different aspects that are involved with the use of these devices such as the number of users for each and their price range. The second part of the article shall cover strengths and weaknesses of this article. Finally, the article shall then cover writers' opinion on the articles and recommendation on what can be done to improve them. Introduction High definition television has brought about some change in the mode of social networking. Thus, with the invention of high definition television (HDTV), there has been remarkable change in video and audio conferencing. Several versions of high definition televisions currently exist in the market including internet enabled ones with built in wireless internet connectivi ty and others with port for wireless or wired connectivity. Since invention of live chat tools by Google and Microsoft, Google+ hangout on air and Skype respectively, there has been increased need to include more users in chat sessions than the logical one user when used in personal computers or smart phones2. Main Themes The main idea of these articles is to analyze and ascertain the extent in which integration between HDTV and chat- enabled devices that have been manufactured. In this article, I shall focus on two essential devices that have been manufactured for this purpose. It shall also cover some issues relating to these devices such as Working capability of these devices The number of users which they support Their price range and connectivity and Their multimedia capability features There has been the invention of Watchitoo device, which was launched for enterprise purposes, and the Tely HD designed for multiple users for home use. These devices according to review articles are ultimately designed to allow for live online streaming of calls, pictures and messages for multiple users using their HDTV sets at the comfort of their homes. The Watchitoo device can allow connection of up to 25 users to the device at the same time and enable them make audio or video calls simultaneously. The Tely HD has been designed to allow family members or small groups of friends to convert their HDTV sets into a live chat device. They are capable of making definition video calls through their HDTV at the comfort of their living room without crowding to a small screen3. In addition, an attractive feature with these devices is that apart from traditional feature whereby devices are independent in communication, these devices have been essentially designed to be fully integrated with already established social networking sites and tools. The Watchitoo has been embedded into users own networking site services like Facebook or Twitter. This allows the user to make video calls and invite friends to chat with them very easily through these sites. The Tely HD has been designed to communicate with all Skype enabled devices in the market. The user can make Skype calls to other Skype enabled devices including other Tely HD televisions, smart phone, personal computers and any other device with inbuilt Skype capability in these devices4.